freestyle 293 atcc n a experimental models Search Results


cell lines chlorocebus sp vero e6 n a n a aav 293 cells atcc n a experimental models  (ATCC)
99
ATCC cell lines chlorocebus sp vero e6 n a n a aav 293 cells atcc n a experimental models
Cell Lines Chlorocebus Sp Vero E6 N A N A Aav 293 Cells Atcc N A Experimental Models, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/freestyle+293+atcc+n+a+experimental+models/Vero/pm35421379-253-132-143
Average 99 stars, based on 1 article reviews
cell lines chlorocebus sp vero e6 n a n a aav 293 cells atcc n a experimental models - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
cell lines 293t cell line atcc n a hela cell line atcc n a u2os cell line atcc n a rpe1 cell line atcc n a u2os ha er asisi cell line gift  (ATCC)
99
ATCC cell lines 293t cell line atcc n a hela cell line atcc n a u2os cell line atcc n a rpe1 cell line atcc n a u2os ha er asisi cell line gift
Figure 4. NEIL3 is required for DSB end resection (A–D) Representative images and statistical analysis to show (A, B) RPA2 foci and (C, D) BrdU foci formation 24 h after 100 ng/mL MMC treatment in WT and NEIL3/ HeLa cells. Scale bar, 10 mm. A total of 100 cells from three independent experiments were analyzed for each group. ***p < 0.001, ****p < 0.0001, two- tailed Student’s t test. (E) The schematic of in vitro DSB end resection assay in ER-AsiSI <t>U2OS</t> cells. See STAR Methods for details. (F) Quantification and statistical analysis of the ssDNA level after depletion of NEIL3, CtIP, and BRCA1, respectively, in ER-AsiSI U2OS cells. Data are shown as mean ± SEM compiled from three independent experiments. **p < 0.01, ***p < 0.001, two-tailed Student’s t test. (G) The efficiency of knockdown of individual proteins was examined by western blot.
Cell Lines 293t Cell Line Atcc N A Hela Cell Line Atcc N A U2os Cell Line Atcc N A Rpe1 Cell Line Atcc N A U2os Ha Er Asisi Cell Line Gift, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/freestyle+293+atcc+n+a+experimental+models/293T/pm36351389-545-121-126
Average 99 stars, based on 1 article reviews
cell lines 293t cell line atcc n a hela cell line atcc n a u2os cell line atcc n a rpe1 cell line atcc n a u2os ha er asisi cell line gift - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
freestyle 293 atcc n a experimental models  (ATCC)
99
ATCC freestyle 293 atcc n a experimental models
Figure 4. NEIL3 is required for DSB end resection (A–D) Representative images and statistical analysis to show (A, B) RPA2 foci and (C, D) BrdU foci formation 24 h after 100 ng/mL MMC treatment in WT and NEIL3/ HeLa cells. Scale bar, 10 mm. A total of 100 cells from three independent experiments were analyzed for each group. ***p < 0.001, ****p < 0.0001, two- tailed Student’s t test. (E) The schematic of in vitro DSB end resection assay in ER-AsiSI <t>U2OS</t> cells. See STAR Methods for details. (F) Quantification and statistical analysis of the ssDNA level after depletion of NEIL3, CtIP, and BRCA1, respectively, in ER-AsiSI U2OS cells. Data are shown as mean ± SEM compiled from three independent experiments. **p < 0.01, ***p < 0.001, two-tailed Student’s t test. (G) The efficiency of knockdown of individual proteins was examined by western blot.
Freestyle 293 Atcc N A Experimental Models, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/freestyle+293+atcc+n+a+experimental+models/293/pm31390572-307-110-112
Average 99 stars, based on 1 article reviews
freestyle 293 atcc n a experimental models - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
cell lines hela cells  (ATCC)
99
ATCC cell lines hela cells
Figure 2. CMTR1 is phosphorylated by CK2 during G1 phase (A) Recombinant CMTR1 was in vitro phosphorylated with CK2 and a titration was blotted onto PVDF (ng indicated). Blots were probed with pCMTR1 antibody or (pan) CMTR1 antibody. (B) HA-CMTR1 WT, HA-CMTR1 15A, or empty vector (v) were transiently expressed in <t>HeLa</t> <t>cells.</t> HA-CMTR1 proteins were immunoprecipitated via the HA tag and analyzed by western blot. (C) FLAG-CK2 WT, D156A (kinase dead [KD]), or empty vector (v) were transiently expressed in HeLa cells. Endogenous CMTR1 was immunoprecipitated and analyzed by western blot. (D) HeLa cells were arrested in G2/M phase using nocodazole and released into the cell cycle by replacement with fresh medium. CMTR1 was immunopre- cipitated over a time course of nocodazole release or from asynchronous cells (A) and analyzed by western blot for phospho-CMTR1 and total CMTR1 (representative shown). Cyclin B expression was analyzed. (legend continued on next page)
Cell Lines Hela Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/freestyle+293+atcc+n+a+experimental+models/HeLa/pm38923463-462-245-254
Average 99 stars, based on 1 article reviews
cell lines hela cells - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
cell lines human hela cells atcc n a human hek293 cells atcc crl 1573 nih 3t3 mouse fibroblast cells atcc n a mouse embryonic stem cells  (ATCC)
99
ATCC cell lines human hela cells atcc n a human hek293 cells atcc crl 1573 nih 3t3 mouse fibroblast cells atcc n a mouse embryonic stem cells
Figure 2. Mapping Polysome-Interacting Proteins (A) Top: overlap of proteins (excluding ribosomal proteins) identified in polysome fractions in our study and the so-called mammalian riboproteome. Bottom: complexes with cytosolic RPs (green bars, including ribosomal proteins) and several non-ribosomal complexes (purple bars) are significantly enriched. (B) To identify ribosome-associated proteins, profiles of individual proteins are compared with the polysome consensus profile by computing MSD values. (C) Observed distribution of MSD values in <t>HEK293</t> cells (green). Cytosolic (red) and mitochondrial RPs (purple) can be easily separated. The MSD value dis- tribution of an exemplarily shuffled dataset is depicted in gray. Multiple shuffling operations were used to define cutoffs (nominal false discovery rate [FDR] = 0). The insets show the reproducibility of MSD values between replicates.
Cell Lines Human Hela Cells Atcc N A Human Hek293 Cells Atcc Crl 1573 Nih 3t3 Mouse Fibroblast Cells Atcc N A Mouse Embryonic Stem Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/freestyle+293+atcc+n+a+experimental+models/293%3B+Embryonic+Kidney%3B+Human/pm30220558-762-121-126
Average 99 stars, based on 1 article reviews
cell lines human hela cells atcc n a human hek293 cells atcc crl 1573 nih 3t3 mouse fibroblast cells atcc n a mouse embryonic stem cells - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
cell lines hek 293t cell atcc n a thp 1 cell atcc n a oligonucleotides gapdh forward primer  (ATCC)
99
ATCC cell lines hek 293t cell atcc n a thp 1 cell atcc n a oligonucleotides gapdh forward primer
Figure 2. Mapping Polysome-Interacting Proteins (A) Top: overlap of proteins (excluding ribosomal proteins) identified in polysome fractions in our study and the so-called mammalian riboproteome. Bottom: complexes with cytosolic RPs (green bars, including ribosomal proteins) and several non-ribosomal complexes (purple bars) are significantly enriched. (B) To identify ribosome-associated proteins, profiles of individual proteins are compared with the polysome consensus profile by computing MSD values. (C) Observed distribution of MSD values in <t>HEK293</t> cells (green). Cytosolic (red) and mitochondrial RPs (purple) can be easily separated. The MSD value dis- tribution of an exemplarily shuffled dataset is depicted in gray. Multiple shuffling operations were used to define cutoffs (nominal false discovery rate [FDR] = 0). The insets show the reproducibility of MSD values between replicates.
Cell Lines Hek 293t Cell Atcc N A Thp 1 Cell Atcc N A Oligonucleotides Gapdh Forward Primer, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/freestyle+293+atcc+n+a+experimental+models/THP-1/pm36181894-195-2-6
Average 99 stars, based on 1 article reviews
cell lines hek 293t cell atcc n a thp 1 cell atcc n a oligonucleotides gapdh forward primer - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

Image Search Results


Figure 4. NEIL3 is required for DSB end resection (A–D) Representative images and statistical analysis to show (A, B) RPA2 foci and (C, D) BrdU foci formation 24 h after 100 ng/mL MMC treatment in WT and NEIL3/ HeLa cells. Scale bar, 10 mm. A total of 100 cells from three independent experiments were analyzed for each group. ***p < 0.001, ****p < 0.0001, two- tailed Student’s t test. (E) The schematic of in vitro DSB end resection assay in ER-AsiSI U2OS cells. See STAR Methods for details. (F) Quantification and statistical analysis of the ssDNA level after depletion of NEIL3, CtIP, and BRCA1, respectively, in ER-AsiSI U2OS cells. Data are shown as mean ± SEM compiled from three independent experiments. **p < 0.01, ***p < 0.001, two-tailed Student’s t test. (G) The efficiency of knockdown of individual proteins was examined by western blot.

Journal: Cell reports

Article Title: NEIL3 contributes to the Fanconi anemia/BRCA pathway by promoting the downstream double-strand break repair step.

doi: 10.1016/j.celrep.2022.111600

Figure Lengend Snippet: Figure 4. NEIL3 is required for DSB end resection (A–D) Representative images and statistical analysis to show (A, B) RPA2 foci and (C, D) BrdU foci formation 24 h after 100 ng/mL MMC treatment in WT and NEIL3/ HeLa cells. Scale bar, 10 mm. A total of 100 cells from three independent experiments were analyzed for each group. ***p < 0.001, ****p < 0.0001, two- tailed Student’s t test. (E) The schematic of in vitro DSB end resection assay in ER-AsiSI U2OS cells. See STAR Methods for details. (F) Quantification and statistical analysis of the ssDNA level after depletion of NEIL3, CtIP, and BRCA1, respectively, in ER-AsiSI U2OS cells. Data are shown as mean ± SEM compiled from three independent experiments. **p < 0.01, ***p < 0.001, two-tailed Student’s t test. (G) The efficiency of knockdown of individual proteins was examined by western blot.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 4-Hydroxytamoxifen Sigma-Aldrich Cat# H7904 Ethidium Bromide Sigma-Aldrich Cat# E8751 Doxycycline Selleck Chemicals Cat# S5159 Hoechst 33,342 Beyotime Technology Cat# C1029 Doxycycline Selleck Chemicals Cat# S5159 Benzonase Sigma-Aldrich Cat# E8263 MG-132 Selleck Chemicals Cat# S2619 Olaparib (AZD2281) Selleck Chemicals Cat# S1060 Critical commercial assays CellTiter-Glo Luminescent Viability Assay Promega Cat# G7570 Subcellular Protein Fractionation Kit Life Technologies Cat# 78840 CometAssay Single Cell Gel Electrophoresis Assay Trevigen Cat# 4250-050-K Hieff Clone Plus One Step Cloning Kit Yeasen Cat# 10911ES20 Immunoprecipitation (IP/CoIP) Kit Absin Cat# abs955 TIANamp Genomic DNA Kit TIANGEN Cat# DP304 PierceTM anti-HA magnetic beads Thermo Fisher Scientific Cat# 88836 PierceTM anti-c-Myc magnetic beads Thermo Fisher Scientific Cat# 88842 GFP-Trap magnetic beads Chromotek Cat# gtma-20 Experimental models: Cell lines 293T Cell Line ATCC N/A HeLa Cell Line ATCC N/A U2OS Cell Line ATCC N/A RPE1 Cell Line ATCC N/A U2OS-HA-ER-AsiSI Cell Line Gift from Dr. Gaëlle Legube N/A U2OS-FANCD2 / Cell Line Li et al., 2020 N/A HeLa-FANCA / Cell Line Li et al., 2020 N/A HeLa-NEIL3 / Cell Line Li et al., 2020 N/A HeLa-NEIL3-WT-Dox Cell line This paper N/A HeLa-NEIL3-del N term-Dox Cell line This paper N/A HeLa-NEIL3-del C term-Dox Cell line This paper N/A HeLa-NEIL3-del GRF2 -Dox Cell line This paper N/A HeLa-NEIL3-del GRF 1-2-Dox Cell line This paper N/A Oligonucleotides siRNA targeting sequence: negative Control: GGGTATCGACGATTACAAA Li et al., 2020 N/A siRNA targeting sequence: NEIL3 #1: GGGTGGATCATGTTATGGA Li et al., 2020 N/A siRNA targeting sequence: NEIL3 #2: GCTAATGGATCAGAACGTA Li et al., 2020 N/A siRNA targeting sequence: NEIL3 #50UTR: TGAGTTGCACAGCGGTATT This paper N/A siRNA targeting sequence: FANCA: TTTTTCCCTCTTGACCCTT Li et al., 2020 N/A siRNA targeting sequence: FANCD2: GGCTCAGGATTCTAATGTA Li et al., 2020 N/A siRNA targeting sequence: NBS1: CCAACTAAATTGCCAAGTA Sangon Biotech N/A (Continued on next page) e2 Cell Reports 41, 111600, November 8, 2022

Techniques: Two Tailed Test, In Vitro, Resection Assay, Knockdown, Western Blot

Figure 6. NEIL3 acts upstream of CtIP and MRN complex to promote their recruitment to DSBs (A) Western blots to validate the expression of GFP-tagged constructs of NEIL3, CtIP, and NBS1, respectively. (B) Representative time-lapse view to show the recruitment of indicated proteins to laser irradiation damaged sites in U2OS cells. Scale bar, 5 mm. (C) Normalized fluorescent intensity curve of indicated proteins at DNA damage sites. (legend continued on next page)

Journal: Cell reports

Article Title: NEIL3 contributes to the Fanconi anemia/BRCA pathway by promoting the downstream double-strand break repair step.

doi: 10.1016/j.celrep.2022.111600

Figure Lengend Snippet: Figure 6. NEIL3 acts upstream of CtIP and MRN complex to promote their recruitment to DSBs (A) Western blots to validate the expression of GFP-tagged constructs of NEIL3, CtIP, and NBS1, respectively. (B) Representative time-lapse view to show the recruitment of indicated proteins to laser irradiation damaged sites in U2OS cells. Scale bar, 5 mm. (C) Normalized fluorescent intensity curve of indicated proteins at DNA damage sites. (legend continued on next page)

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 4-Hydroxytamoxifen Sigma-Aldrich Cat# H7904 Ethidium Bromide Sigma-Aldrich Cat# E8751 Doxycycline Selleck Chemicals Cat# S5159 Hoechst 33,342 Beyotime Technology Cat# C1029 Doxycycline Selleck Chemicals Cat# S5159 Benzonase Sigma-Aldrich Cat# E8263 MG-132 Selleck Chemicals Cat# S2619 Olaparib (AZD2281) Selleck Chemicals Cat# S1060 Critical commercial assays CellTiter-Glo Luminescent Viability Assay Promega Cat# G7570 Subcellular Protein Fractionation Kit Life Technologies Cat# 78840 CometAssay Single Cell Gel Electrophoresis Assay Trevigen Cat# 4250-050-K Hieff Clone Plus One Step Cloning Kit Yeasen Cat# 10911ES20 Immunoprecipitation (IP/CoIP) Kit Absin Cat# abs955 TIANamp Genomic DNA Kit TIANGEN Cat# DP304 PierceTM anti-HA magnetic beads Thermo Fisher Scientific Cat# 88836 PierceTM anti-c-Myc magnetic beads Thermo Fisher Scientific Cat# 88842 GFP-Trap magnetic beads Chromotek Cat# gtma-20 Experimental models: Cell lines 293T Cell Line ATCC N/A HeLa Cell Line ATCC N/A U2OS Cell Line ATCC N/A RPE1 Cell Line ATCC N/A U2OS-HA-ER-AsiSI Cell Line Gift from Dr. Gaëlle Legube N/A U2OS-FANCD2 / Cell Line Li et al., 2020 N/A HeLa-FANCA / Cell Line Li et al., 2020 N/A HeLa-NEIL3 / Cell Line Li et al., 2020 N/A HeLa-NEIL3-WT-Dox Cell line This paper N/A HeLa-NEIL3-del N term-Dox Cell line This paper N/A HeLa-NEIL3-del C term-Dox Cell line This paper N/A HeLa-NEIL3-del GRF2 -Dox Cell line This paper N/A HeLa-NEIL3-del GRF 1-2-Dox Cell line This paper N/A Oligonucleotides siRNA targeting sequence: negative Control: GGGTATCGACGATTACAAA Li et al., 2020 N/A siRNA targeting sequence: NEIL3 #1: GGGTGGATCATGTTATGGA Li et al., 2020 N/A siRNA targeting sequence: NEIL3 #2: GCTAATGGATCAGAACGTA Li et al., 2020 N/A siRNA targeting sequence: NEIL3 #50UTR: TGAGTTGCACAGCGGTATT This paper N/A siRNA targeting sequence: FANCA: TTTTTCCCTCTTGACCCTT Li et al., 2020 N/A siRNA targeting sequence: FANCD2: GGCTCAGGATTCTAATGTA Li et al., 2020 N/A siRNA targeting sequence: NBS1: CCAACTAAATTGCCAAGTA Sangon Biotech N/A (Continued on next page) e2 Cell Reports 41, 111600, November 8, 2022

Techniques: Western Blot, Expressing, Construct, Irradiation

Figure 2. CMTR1 is phosphorylated by CK2 during G1 phase (A) Recombinant CMTR1 was in vitro phosphorylated with CK2 and a titration was blotted onto PVDF (ng indicated). Blots were probed with pCMTR1 antibody or (pan) CMTR1 antibody. (B) HA-CMTR1 WT, HA-CMTR1 15A, or empty vector (v) were transiently expressed in HeLa cells. HA-CMTR1 proteins were immunoprecipitated via the HA tag and analyzed by western blot. (C) FLAG-CK2 WT, D156A (kinase dead [KD]), or empty vector (v) were transiently expressed in HeLa cells. Endogenous CMTR1 was immunoprecipitated and analyzed by western blot. (D) HeLa cells were arrested in G2/M phase using nocodazole and released into the cell cycle by replacement with fresh medium. CMTR1 was immunopre- cipitated over a time course of nocodazole release or from asynchronous cells (A) and analyzed by western blot for phospho-CMTR1 and total CMTR1 (representative shown). Cyclin B expression was analyzed. (legend continued on next page)

Journal: Cell reports

Article Title: CK2 phosphorylation of CMTR1 promotes RNA cap formation and influenza virus infection.

doi: 10.1016/j.celrep.2024.114405

Figure Lengend Snippet: Figure 2. CMTR1 is phosphorylated by CK2 during G1 phase (A) Recombinant CMTR1 was in vitro phosphorylated with CK2 and a titration was blotted onto PVDF (ng indicated). Blots were probed with pCMTR1 antibody or (pan) CMTR1 antibody. (B) HA-CMTR1 WT, HA-CMTR1 15A, or empty vector (v) were transiently expressed in HeLa cells. HA-CMTR1 proteins were immunoprecipitated via the HA tag and analyzed by western blot. (C) FLAG-CK2 WT, D156A (kinase dead [KD]), or empty vector (v) were transiently expressed in HeLa cells. Endogenous CMTR1 was immunoprecipitated and analyzed by western blot. (D) HeLa cells were arrested in G2/M phase using nocodazole and released into the cell cycle by replacement with fresh medium. CMTR1 was immunopre- cipitated over a time course of nocodazole release or from asynchronous cells (A) and analyzed by western blot for phospho-CMTR1 and total CMTR1 (representative shown). Cyclin B expression was analyzed. (legend continued on next page)

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-IFIT3 rabbit polyclonal Proteintech 15201-1-AP; RRID:AB_2248738 Anti-ISG15 mouse monoclonal Santa Cruz sc-166755; RRID:AB_2126308 Anti-Actin mouse monoclonal Santa Cruz sc-47778; RRID:AB_626632 Anti-CMTR1 rabbit polyclonal Sigma-Aldrich HPA029954; RRID:AB_10670558 Anti-CMTR1 sheep polyclonal University of Dundee N/A Anti-HA (Clone 16B12) Biolegend 901514; RRID:AB_2565336 Anti-pCMTR1 sheep polyclonal University of Dundee N/A Anti RNAPII 5SP rat polyclonal Chromotek 3E8; RRID:AB_2631404 Anti RNA PII 2SP rat polyclonal Chromotek 3E10; RRID:AB_2631403 Anti RNA PII (clone D8L4Y) Cell Signaling #14958; RRID:AB_2687876 Anti-DHX15 rabbit polyclonal Abcam ab254591; RRID:AB_2892059 Goat anti-Rabbit IgG (H + L) Secondary Antibody, HRP conjugate Thermo Fisher 31460; RRID:AB_228341 Goat anti-Mouse IgG (H + L) Secondary Antibody, HRP conjugate Thermo Fisher 31430; RRID:AB_228307 Rabbit anti-Sheep IgG (H + L) Secondary Antibody, HRP conjugate Thermo Fisher 31480; RRID:AB_228457 Goat anti-Rat IgG (H + L) Secondary Antibody, HRP conjugate Thermo Fisher 31470; RRID:AB_228356 IRDye 680RD Donkey anti-Mouse IgG (H + L) LI-COR Biotechnology 926–68072; RRID:AB_10953628 IRDye 680RD Donkey anti-Rabbit IgG (H + L) LI-COR Biotechnology 926–68073; RRID:AB_10954442 IRDye 800CW Donkey anti-Rabbit IgG (H + L) LI-COR Biotechnology 926–32213; RRID:AB_621848 IRDye 680RD Donkey anti-Goat IgG (H + L) LI-COR Biotechnology 926–68074; RRID:AB_10956736 Chemicals, Peptides, and Recombinant Proteins Recombinant human CMTR1 Full length Division of Signal Transduction Therapies N/A Recombinant human CMTR1 Full length d1-143 Division of Signal Transduction Therapies N/A Recombinant CK2 Division of Signal Transduction Therapies N/A Recombinant OTUB1 Division of Signal Transduction Therapies N/A Deposited data RNA seq datasets This paper GSE124996 NCBI GEO database Experimental models: Cell lines HeLa cells (human cervical cancer cell line) ATCC N/A HEK 293 cells (Human embryonic kidney cell line) ATCC N/A Experimental models: Primary Cell cultures Mouse Embryonic Fibroblasts (MEFs) Cmtr1 fl/fl This paper N/A Experimental models: Organisms/Strains Cmtr1 fl/fl mice w/loxP sites flanking exon 3 of Cmtr1 Taconic Artemis Gmbh N/A Oligonucleotides IFIT1 F GAGGTTGTGCATCCCCAATG This paper N/A IFIT1 R GCTACCACCTTTACAGCAACC This paper N/A (Continued on next page) Cell Reports 43, 114405, July 23, 2024 15

Techniques: Recombinant, In Vitro, Titration, Plasmid Preparation, Immunoprecipitation, Western Blot, Expressing

Figure 3. CK2 phosphorylation of CMTR1 increased interaction with RNA Pol II (A and B) HA-CMTR1 WT, 15A, or vector control. Dots indicate data were transiently expressed in (A) MEFs or (B) HeLa cells. HA-CMTR1 WT or 15A was immunoprecipitated from cell extracts via the HA tag. Western blots were performed on input material and immunoprecipitates (IPs). (C) HA-CMTR1 was transiently co-expressed in HeLa cells with CK2 WT, CK2 KD, or vector control. Western blots were performed on input material and HA- CMTR1 IPs for the antigens indicated. (D) Recombinant GST-CMTR1 was incubated with biotinylated CTD peptide, unphosphorylated (CTD), or phosphorylated on serine-5 (CTD S5P). CMTR1 was detected by western blot in inputs and streptavidin pull-downs (Aff). (E) As in (D) except GST-CMTR1 was in vitro phosphorylated by incubation with CK2 prior to CTD and CTD-S5P pull-downs. (F) GST-CMTR1 binding to CTD was quantitated for 4 independent experiments Dots indicate data, and line indicates the average. Student’s t test was per- formed, and p values are stated.

Journal: Cell reports

Article Title: CK2 phosphorylation of CMTR1 promotes RNA cap formation and influenza virus infection.

doi: 10.1016/j.celrep.2024.114405

Figure Lengend Snippet: Figure 3. CK2 phosphorylation of CMTR1 increased interaction with RNA Pol II (A and B) HA-CMTR1 WT, 15A, or vector control. Dots indicate data were transiently expressed in (A) MEFs or (B) HeLa cells. HA-CMTR1 WT or 15A was immunoprecipitated from cell extracts via the HA tag. Western blots were performed on input material and immunoprecipitates (IPs). (C) HA-CMTR1 was transiently co-expressed in HeLa cells with CK2 WT, CK2 KD, or vector control. Western blots were performed on input material and HA- CMTR1 IPs for the antigens indicated. (D) Recombinant GST-CMTR1 was incubated with biotinylated CTD peptide, unphosphorylated (CTD), or phosphorylated on serine-5 (CTD S5P). CMTR1 was detected by western blot in inputs and streptavidin pull-downs (Aff). (E) As in (D) except GST-CMTR1 was in vitro phosphorylated by incubation with CK2 prior to CTD and CTD-S5P pull-downs. (F) GST-CMTR1 binding to CTD was quantitated for 4 independent experiments Dots indicate data, and line indicates the average. Student’s t test was per- formed, and p values are stated.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-IFIT3 rabbit polyclonal Proteintech 15201-1-AP; RRID:AB_2248738 Anti-ISG15 mouse monoclonal Santa Cruz sc-166755; RRID:AB_2126308 Anti-Actin mouse monoclonal Santa Cruz sc-47778; RRID:AB_626632 Anti-CMTR1 rabbit polyclonal Sigma-Aldrich HPA029954; RRID:AB_10670558 Anti-CMTR1 sheep polyclonal University of Dundee N/A Anti-HA (Clone 16B12) Biolegend 901514; RRID:AB_2565336 Anti-pCMTR1 sheep polyclonal University of Dundee N/A Anti RNAPII 5SP rat polyclonal Chromotek 3E8; RRID:AB_2631404 Anti RNA PII 2SP rat polyclonal Chromotek 3E10; RRID:AB_2631403 Anti RNA PII (clone D8L4Y) Cell Signaling #14958; RRID:AB_2687876 Anti-DHX15 rabbit polyclonal Abcam ab254591; RRID:AB_2892059 Goat anti-Rabbit IgG (H + L) Secondary Antibody, HRP conjugate Thermo Fisher 31460; RRID:AB_228341 Goat anti-Mouse IgG (H + L) Secondary Antibody, HRP conjugate Thermo Fisher 31430; RRID:AB_228307 Rabbit anti-Sheep IgG (H + L) Secondary Antibody, HRP conjugate Thermo Fisher 31480; RRID:AB_228457 Goat anti-Rat IgG (H + L) Secondary Antibody, HRP conjugate Thermo Fisher 31470; RRID:AB_228356 IRDye 680RD Donkey anti-Mouse IgG (H + L) LI-COR Biotechnology 926–68072; RRID:AB_10953628 IRDye 680RD Donkey anti-Rabbit IgG (H + L) LI-COR Biotechnology 926–68073; RRID:AB_10954442 IRDye 800CW Donkey anti-Rabbit IgG (H + L) LI-COR Biotechnology 926–32213; RRID:AB_621848 IRDye 680RD Donkey anti-Goat IgG (H + L) LI-COR Biotechnology 926–68074; RRID:AB_10956736 Chemicals, Peptides, and Recombinant Proteins Recombinant human CMTR1 Full length Division of Signal Transduction Therapies N/A Recombinant human CMTR1 Full length d1-143 Division of Signal Transduction Therapies N/A Recombinant CK2 Division of Signal Transduction Therapies N/A Recombinant OTUB1 Division of Signal Transduction Therapies N/A Deposited data RNA seq datasets This paper GSE124996 NCBI GEO database Experimental models: Cell lines HeLa cells (human cervical cancer cell line) ATCC N/A HEK 293 cells (Human embryonic kidney cell line) ATCC N/A Experimental models: Primary Cell cultures Mouse Embryonic Fibroblasts (MEFs) Cmtr1 fl/fl This paper N/A Experimental models: Organisms/Strains Cmtr1 fl/fl mice w/loxP sites flanking exon 3 of Cmtr1 Taconic Artemis Gmbh N/A Oligonucleotides IFIT1 F GAGGTTGTGCATCCCCAATG This paper N/A IFIT1 R GCTACCACCTTTACAGCAACC This paper N/A (Continued on next page) Cell Reports 43, 114405, July 23, 2024 15

Techniques: Phospho-proteomics, Plasmid Preparation, Control, Immunoprecipitation, Western Blot, Recombinant, Incubation, In Vitro, Binding Assay

Figure 2. Mapping Polysome-Interacting Proteins (A) Top: overlap of proteins (excluding ribosomal proteins) identified in polysome fractions in our study and the so-called mammalian riboproteome. Bottom: complexes with cytosolic RPs (green bars, including ribosomal proteins) and several non-ribosomal complexes (purple bars) are significantly enriched. (B) To identify ribosome-associated proteins, profiles of individual proteins are compared with the polysome consensus profile by computing MSD values. (C) Observed distribution of MSD values in HEK293 cells (green). Cytosolic (red) and mitochondrial RPs (purple) can be easily separated. The MSD value dis- tribution of an exemplarily shuffled dataset is depicted in gray. Multiple shuffling operations were used to define cutoffs (nominal false discovery rate [FDR] = 0). The insets show the reproducibility of MSD values between replicates.

Journal: Molecular cell

Article Title: Phosphorylation of the Ribosomal Protein RPL12/uL11 Affects Translation during Mitosis.

doi: 10.1016/j.molcel.2018.08.019

Figure Lengend Snippet: Figure 2. Mapping Polysome-Interacting Proteins (A) Top: overlap of proteins (excluding ribosomal proteins) identified in polysome fractions in our study and the so-called mammalian riboproteome. Bottom: complexes with cytosolic RPs (green bars, including ribosomal proteins) and several non-ribosomal complexes (purple bars) are significantly enriched. (B) To identify ribosome-associated proteins, profiles of individual proteins are compared with the polysome consensus profile by computing MSD values. (C) Observed distribution of MSD values in HEK293 cells (green). Cytosolic (red) and mitochondrial RPs (purple) can be easily separated. The MSD value dis- tribution of an exemplarily shuffled dataset is depicted in gray. Multiple shuffling operations were used to define cutoffs (nominal false discovery rate [FDR] = 0). The insets show the reproducibility of MSD values between replicates.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 3P for B cells This paper ProteomeXchange: PXD009267 pSILAC in B cells This paper ProteomeXchange: PXD009276 PRM assay in B cells This paper ProteomeXchange: PXD010029 RNA-seq and ribo-seq datasets This paper GEO: GSE112187 Human UniprotKB/Swiss-Prot data base (Human UniProt 2014-10) N/A https://www.uniprot.org/proteomes/ Mouse UniprotKB/Swiss-Prot data base (Mouse UniProt 2014-10) N/A https://www.uniprot.org/proteomes/ Riboproteome data Reschke et al., 2013 N/A Ribosome profiling data (mitosis versus S phase) Stumpf et al., 2013 N/A Protein complex annotation data (CORUM downloaded Jan/2017) Ruepp et al., 2010 https://mips.helmholtz-muenchen.de/corum/ STRING protein interaction database Szklarczyk et al., 2017 https://string-db.org/ RNAi data for ribosome biogenesis proteins Badertscher et al., 2015; Wild et al., 2010 N/A Original western blot images This paper Mendeley: https://doi.org/10.17632/sgmwr9z28b.1 Experimental Models: Cell Lines Human HeLa cells ATCC N/A Human HEK293 cells ATCC CRL-1573 NIH 3T3 mouse fibroblast cells ATCC N/A Mouse embryonic stem cells (E14) Michel Vermeulen (Radboud Institute for Molecular Life Sciences N/A Flp-In T-REx 293 Cell Line Thermo Fisher Scientific R78007 19DN mouse B cells and RPL12 mutant cells Sander et al., 2012; this paper N/A Oligonucleotides Oligonucleotides used for genome editing This paper see Generation of RPL12 Point Mutant Cell Lines via CRISPR/Cas9 Recombinant DNA pDONR221 Thermo Fisher Scientific Cat#12536017 pDEST26_FLAG and HA This paper N/A pcDNA5-FLAG and HA-RPL12-WT This paper N/A pcDNA5-FLAG and HA-RPL12-S38D This paper N/A pcDNA5-FLAG and HA-RPL12-S38A This paper N/A pFRT/TO/FLAG/HA-DEST Thomas Tuschl Addgene ID: 26360 pX330-Cas9-RPL12sgRNA This paper N/A pX330-E2A-mCherry Chu et al., 2015 N/A Software and Algorithms R studio v.1.1.4 N/A https://www.rstudio.com MaxQuant v.1.5.1.2 Cox and Mann, 2008 http://www.biochem.mpg.de/5111795/maxquant Metascape Tripathi et al., 2015 http://metascape.org/ Bcl2Fastq v.2.16.0.10 Illumina https://support.illumina.com/sequencing/ sequencing_software/bcl2fastq-conversionsoftware.html Flexbar v.2.5 Roehr et al., 2017 https://github.com/seqan/flexbar/wiki collapse_reads.pl script Jens, 2016 https://github.com/marvin-jens/clip_analysis STAR aligner v.2.4.2a, v.2.5.3a Dobin et al., 2013 https://github.com/alexdobin/STAR DESeq2 v.1.18.1 Love et al., 2014 https://bioconductor.org/packages/release/ bioc/html/DESeq2.html (Continued on next page) Molecular Cell 72, 1–15.e1–e9, October 4, 2018 e2

Techniques:

Figure 4. Effect of RPL12/uL11 pS38 on Global Protein Synthesis (A) Conservation and phosphorylation motif of RPL12/uL11 S38. (B) Phosphorylation of S38 during the cell cycle in published phosphoproteomics data. (C) Experimental design for flow cytometric analysis of mitotic translation in HEK293 cells transiently expressing FLAG and HA-tagged RPL12/uL11. (D) Monitoring global protein synthesis in interphase and mitosis. Left: representative FACS result of cells expressing FLAG and HA RPL12/uL11 WT. Only cells expressing tagged RPL12/uL11 were gated, and the corresponding cell population was further analyzed by dual staining for phospho-H3 S10 and AHA-labeled proteins. Global protein synthesis was monitored by AHA incorporation (y axis) in interphase and mitosis (based on H3 pS10 staining, x axis). Right: each dot represents median AHA intensity calculated from the interphase or mitotic cell population in an independent experiment. The results from three independent experiments are shown. As controls, methionine (Met) incorporation into proteins instead of AHA and protein production in the presence of cycloheximide (CHX) were also monitored. (E) Mitotic index determined by flow cytometric analysis of H3 pS10-positive cells expressing tagged RPL12/uL11. Data are represented as mean ± SD. The p values were calculated using paired Student’s t test.

Journal: Molecular cell

Article Title: Phosphorylation of the Ribosomal Protein RPL12/uL11 Affects Translation during Mitosis.

doi: 10.1016/j.molcel.2018.08.019

Figure Lengend Snippet: Figure 4. Effect of RPL12/uL11 pS38 on Global Protein Synthesis (A) Conservation and phosphorylation motif of RPL12/uL11 S38. (B) Phosphorylation of S38 during the cell cycle in published phosphoproteomics data. (C) Experimental design for flow cytometric analysis of mitotic translation in HEK293 cells transiently expressing FLAG and HA-tagged RPL12/uL11. (D) Monitoring global protein synthesis in interphase and mitosis. Left: representative FACS result of cells expressing FLAG and HA RPL12/uL11 WT. Only cells expressing tagged RPL12/uL11 were gated, and the corresponding cell population was further analyzed by dual staining for phospho-H3 S10 and AHA-labeled proteins. Global protein synthesis was monitored by AHA incorporation (y axis) in interphase and mitosis (based on H3 pS10 staining, x axis). Right: each dot represents median AHA intensity calculated from the interphase or mitotic cell population in an independent experiment. The results from three independent experiments are shown. As controls, methionine (Met) incorporation into proteins instead of AHA and protein production in the presence of cycloheximide (CHX) were also monitored. (E) Mitotic index determined by flow cytometric analysis of H3 pS10-positive cells expressing tagged RPL12/uL11. Data are represented as mean ± SD. The p values were calculated using paired Student’s t test.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 3P for B cells This paper ProteomeXchange: PXD009267 pSILAC in B cells This paper ProteomeXchange: PXD009276 PRM assay in B cells This paper ProteomeXchange: PXD010029 RNA-seq and ribo-seq datasets This paper GEO: GSE112187 Human UniprotKB/Swiss-Prot data base (Human UniProt 2014-10) N/A https://www.uniprot.org/proteomes/ Mouse UniprotKB/Swiss-Prot data base (Mouse UniProt 2014-10) N/A https://www.uniprot.org/proteomes/ Riboproteome data Reschke et al., 2013 N/A Ribosome profiling data (mitosis versus S phase) Stumpf et al., 2013 N/A Protein complex annotation data (CORUM downloaded Jan/2017) Ruepp et al., 2010 https://mips.helmholtz-muenchen.de/corum/ STRING protein interaction database Szklarczyk et al., 2017 https://string-db.org/ RNAi data for ribosome biogenesis proteins Badertscher et al., 2015; Wild et al., 2010 N/A Original western blot images This paper Mendeley: https://doi.org/10.17632/sgmwr9z28b.1 Experimental Models: Cell Lines Human HeLa cells ATCC N/A Human HEK293 cells ATCC CRL-1573 NIH 3T3 mouse fibroblast cells ATCC N/A Mouse embryonic stem cells (E14) Michel Vermeulen (Radboud Institute for Molecular Life Sciences N/A Flp-In T-REx 293 Cell Line Thermo Fisher Scientific R78007 19DN mouse B cells and RPL12 mutant cells Sander et al., 2012; this paper N/A Oligonucleotides Oligonucleotides used for genome editing This paper see Generation of RPL12 Point Mutant Cell Lines via CRISPR/Cas9 Recombinant DNA pDONR221 Thermo Fisher Scientific Cat#12536017 pDEST26_FLAG and HA This paper N/A pcDNA5-FLAG and HA-RPL12-WT This paper N/A pcDNA5-FLAG and HA-RPL12-S38D This paper N/A pcDNA5-FLAG and HA-RPL12-S38A This paper N/A pFRT/TO/FLAG/HA-DEST Thomas Tuschl Addgene ID: 26360 pX330-Cas9-RPL12sgRNA This paper N/A pX330-E2A-mCherry Chu et al., 2015 N/A Software and Algorithms R studio v.1.1.4 N/A https://www.rstudio.com MaxQuant v.1.5.1.2 Cox and Mann, 2008 http://www.biochem.mpg.de/5111795/maxquant Metascape Tripathi et al., 2015 http://metascape.org/ Bcl2Fastq v.2.16.0.10 Illumina https://support.illumina.com/sequencing/ sequencing_software/bcl2fastq-conversionsoftware.html Flexbar v.2.5 Roehr et al., 2017 https://github.com/seqan/flexbar/wiki collapse_reads.pl script Jens, 2016 https://github.com/marvin-jens/clip_analysis STAR aligner v.2.4.2a, v.2.5.3a Dobin et al., 2013 https://github.com/alexdobin/STAR DESeq2 v.1.18.1 Love et al., 2014 https://bioconductor.org/packages/release/ bioc/html/DESeq2.html (Continued on next page) Molecular Cell 72, 1–15.e1–e9, October 4, 2018 e2

Techniques: Phospho-proteomics, Expressing, Staining, Labeling